Get help from the best in academic writing.

Heteroplasmy and Response Against Azoxystrobin in Cercospora

Heteroplasmy and Response Against Azoxystrobin in Cercospora. Introduction The quinone outside inhibitor (QoI) or Strobilurin is one of the most important fungicides used to control fungal and some Oomycetes pathogens in agricultural crops. This class of fungicide was first isolated from a wood-rotting fungus called Strobilurus tenacellus. Several chemically modified derivatives of natural fungicide, Strobilurin A, are available which are more stable, efficacious, less harmful to human and environment. These fungicides are commercially available with different names and active ingredients: azoxystrobin (Syngenta), fenamidone (Bayer), fluoxastrobin (Arysta), kresoxim methyl (Cheminova), pyraclostrobin (BASF) and trifloxystrobin (Bayer) (Bartlett et al., 2002; Vincelli, 2012). QoI fungicides exhibit both translaminar (across leaf blade) and weak systemic movement within the plant. All QoI fungicides have the same mode of action which disrupt mitochondrial respiration and prevent energy production inside fungal cells (Vincelli 2012). The disruption of ATP generation occurs because of binding of strobilurin at Qo site of cytochrome b hence preventing electron transport from cytochrome b to cytochrome c1 (Bartlett et al., 2002). QoI fungicides are applied to control a broad range of plant pathogens including fungi, water molds, downy mildews, powdery mildews and rusts (Vincelli, 2012). They are mainly used as protective and curative fungicides because of effective action against spore germination and penetration (Balba, 2007). The eradicative property has also been reported by preventing sporulation of fungal pathogen (Anesiadis et al., 2003). More than 50 species of plant pathogens resistant to QoI fungicides has been reported and there is a high risk of selecting resistant isolates in the field (Fungicide Resistant Action Committee, 2013). Three different point mutation in mitochondrial cytochrome b gene has been associated with resistant mechanism against QoI fungicide. The primary mechanism of resistance is by amino acid substitution from glycine to alanine at 143rd codon (G143A) (Bartlett et al., 2002). Other two point mutation at cytochrome b gene is the substitution of phenylalanine with leucine at position 129 (F129L) and glycine with arginine at position 137 (G137R) which confer QoI resistance (Fernández-Ortuño et al. 2010). Another mechanism has also been identified that can bypass the blockage of electron transfer. Alternative oxidase (AOX) is a strobilurin-insensitive terminal oxidase which can bypass electron transfer in Complex III and Salicylhydroxamic acid (SHAM) is an active inhibitor of AOX (Wood and Hollomon, 2003). Resistant mechanism of C. sojina against QoI fungicides is associated with a mitochondrial genome which is present in multiple copies within a single cell. The coexistence of wild and mutated alleles in QoI resistant/sensitive locus has been reported in several other fungal pathogens such as Corynespora cassiicola, Collectotrichumgloeosporioides, Venturia inequalis and Mycovellosiella nattrassii (Ishii et al., 2007; Villani and Cox, 2014). The proportion of wild and mutant allele in the mitochondrial genome has a major role for quantitative resistance (Villani and Cox, 2014). Protective efficacy of the full dose of azoxystrobin against powdery and downy mildew has been found to decrease as populations contained 10% resistant isolates (Ishii et al., 2007). There have been reports of loss of resistance stability in the absence of selection pressure and vice versa (Fraaije et al., 2002; Ishii et al., 2007). The main objectives of this study are to i) identify heteroplasmy in Cercospora sojina; ii) monitor the proportion of resistant and sensitive allele in the presence of selection pressure in the laboratory; and, iii) study the sensitivity of C. sojina against azoxystrobin. Materials and Methods Isolate selection and development of single spore cultures Isolates of C. sojina were screened for resistant and sensitive allele using Taqman assay. After screening, three isolates each having resistant and sensitive alleles were chosen for single spore cultures. Isolates were transferred to V8-RA media and grown in dark cabinet to enhance sporulation. After three weeks, plated were flooded with water and filtered with muslin filter cloth. Water was observed under dissecting microscope to identify single spores. Sterilized needed were used to pick single spore and transferred to new V8-RA plates. Culture was left at room temperature, mycelium harvested, lyophilized and DNA was extracted. Radial growth study A total of two isolates: 158-1 (resistant) and 312-1 (sensitive) were selected for fungicide sensitivity and radial growth study. Four different concentrations of azoxystrobin including control were used to culture both isolates in two replications. Technical grade formulation of azoxystrobin (0.104 gm) (96% a.i.; Syngenta Crop Protection) was used to make 100,000 µg a.i./ml stock in 1 ml acetone. Serial dilution was done to make four different concentration stocks: 10,000, 1000, 100 and 100 µg a.i./ml. V8 media was prepared with four different concentrations (10, 1, 0.1, 0.01 µg a.i./ml) by adding 1ml of respective fungicide stock in 1 liter of media. All four media along with control was amended with salicylhydroxamic acid (SHAM) at 60 µg a.i./ml. Two straight line at 90o were drawn at the center of the plate. For resistant and sensitive isolates, a 5 mm mycelium disc was taken and placed at the center of amended plates in two replications. For each plate, diameters of growth were measured at the interval of 11, 21 and 30 days. Mycelium disc from amended plates was again transferred to the newly amended plate after 10 days. Diameters were measured similarly for three generations. Taqman assay and Sanger sequencing The G/C point mutation in cytochrome b gene will be discriminated by Taqman assay consisting of two dyes. VIC can detect resistant allele ‘C’ and FAM can detect sensitive allele ‘G’. Threshold cycle or Ct of two dyes will be used in detecting the presence of two alleles in a single spore culture. Ct value is the cycle number at which the fluorescence generated crosses the threshold fluorescence and is inversely proportional to the amount of nucleic acid. Lower Ct indicates higher copies in the sample. Sanger sequencing will be done to confirm the presence of both alleles in a single spore. Two primers pairs (Forward: 5′ CTCATTAAATTAGTAATAACTGTGGC 3′ and Reverse: 5′ TAATACAGCTTCAGCATTTTTCTTCT 3′ ) will be used to amplify a part of cytochrome b gene. PCR reaction will be done in a total volume of 25 µl consisting of 1.25 µl (10 µM) of each primer, 12.5 µl of 2x Veriseq PCR mix (Enzymatics Inc.), 1.25 µl DNA and 8.5 µl water and run in following settings: initial denaturation at 94° C for 2 min followed by 29 cycles of denaturation at 94° C for 20 s, annealing at 55° C for 25 s, extension at 72° C for 1 min and final extension at 72° C for 10 min. Data analysis Sequences derived from Sanger sequencing will be aligned to publicly available cytochrome b gene of C. sojina. The QoI resistant/sensitive point mutation locus will be observed for Heterozygosity. The proportions of resistant and sensitive alleles will be calculated based on Ct values and statistical analysis will be performed to compare among different generations. The percent growth inhibition will be calculated as: ([colony diameter on control media – 5 mm] – [colony diameter on fungicide amended media – 5 mm]) / ([colony diameter on control media – 5 mm]) x 100. Further, radial growth of the same isolate among three generations and four different treatments will be compared statistically. Expected results This study will help to explore if heteroplasmy exists in C. sojina as in other Cercospora species. The proportion of resistant and sensitive isolates determines the extent of disease, so it is important to know this ratio. In vitro assay to check the sensitivity of isolates against azoxystrobin at different concentration in a different generation will help to understand the effect of selection pressure. Further measurement of resistant and sensitive proportion with qPCR would help to determine the change occurred in following generations. Genetic study after fungicide treatment will also contribute in identifying changes due to selection pressure. References Anesiadis T, Karaoglanidis G and Tzavella‐Klonari K. 2003. Protective, curative and eradicant activity of the strobilurin fungicide azoxystrobin against Cercospora beticola and Erysiphe betae. Journal of Phytopathology 151(11‐12):647-651. Balba H. 2007. Review of strobilurin fungicide chemicals. Journal of Environmental Science and Health Part B 42(4):441-451. Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer M and Parr‐Dobrzanski B. 2002. The strobilurin fungicides. Pest management science 58(7):649-662. Fernández-Ortuño D, Torés JA, De Vicente A and Pérez-García A. 2010. Mechanisms of resistance to QoI fungicides in phytopathogenic fungi. International Microbiology 11(1):1-9. Fraaije B, Butters J, Coelho J, Jones D and Hollomon D. 2002. Following the dynamics of strobilurin resistance in Blumeria graminis f. sp. tritici using quantitative allele‐specific real‐time PCR measurements with the fluorescent dye SYBR Green I. Plant pathology 51(1):45-54. Fungicide Resistant Action Committee. 2013. List of plant pathogenic organisms resistant to disease control agents. http://www.frac.info/docs/default-source/publications/list-of-resistant-plant-pathogens/list-of-resistant-plant-pathogenic-organisms—february-2013.pdf?sfvrsn=4. Ishii H, Yano K, Date H, Furuta A, Sagehashi Y, Yamaguchi T, Sugiyama T, Nishimura K and Hasama W. 2007. Molecular characterization and diagnosis of QoI resistance in cucumber and eggplant fungal pathogens. Phytopathology 97(11):1458-1466. Villani SM and Cox KD. 2014. Heteroplasmy of the cytochrome b gene in Venturia inaequalis and its involvement in quantitative and practical resistance to trifloxystrobin. Phytopathology 104(9):945-953. Vincelli P. 2012. QoI (Strobilurin) Fungicides: Benefits and Risks. The Plant Health Instructor. DOI: 10.1094/PHI-I-2002-0809-0. Wood PM and Hollomon DW. 2003. A critical evaluation of the role of alternative oxidase in the performance of strobilurin and related fungicides acting at the Qo site of complex III. Pest management science 59(5):499-511. Heteroplasmy and Response Against Azoxystrobin in Cercospora
Indiana State University Measures of Tendency and Dispersion Essay.

Description:Identifying the mean, median, and/or mode for a dataset or a group is values is not challenging. What may be challenging is to know which of those three is the proper measure of center for a dataset.Do some research on the differences of those measures, and provide a specific example when only one of those is appropriate.Example: If I review the prices of vegetables in my local supermarket that sells 147 different produce types, I just need to find the mean of those. The reason is that all have a common property, that they are all sold to the same customers. There is no significant difference on their prices – I just want to know what is the center price per pound for the vegetables. Is it true, though, that the average (mean) of produce prices per pound will always be the center? If instead I had to do the same experiment in a small store of herbs and spices, should I use the mean or the median and why?You should come up with your own example and work with different data. Be specific, and explain your rationale. If you use outside sources (not required), make sure to cite your references.
Indiana State University Measures of Tendency and Dispersion Essay

Civil Disobedience Movement 1930-1934

The Civil Disobedience Movement led by M K Gandhi, in the year 1930 was an important milestone in the history of Indian Nationalism. During the Non-Cooperation Movement, the Indians learnt how philosophical tenets like ‘non violence’ and ‘passive resistance’ could be used to wage political battles. The programs and policies adopted in the movements spearheaded by Gandhi reflected his political ideologies of ahimsa and satyagraha. While the Non-Cooperation Movement was built on the lines of ‘non violent-non-cooperation’, the essence of The Civil Disobedience Movement was ‘defying of the British laws’. Through his leadership to the National Movements, he not only buttressed his political stance but also played a crucial role in unification of the country, awakening of the masses, and bringing politics within the arena of the common man. Causes of the Civil Disobedience Movement Simon Commission: One of the main factors was the Simon Commission. This was formed by the British Government that included solely the members of the British Parliament, in November 1927, to draft and formalize a constitution for India. The chairmanship of the commission rested with Sir John Simon, who was a well known lawyer and an English statesman. Accused of being an ‘All-White Commission’, the Simon Commission was rejected by all political and social segments of the country. In Bengal, the opposition to the Simon Commission assumed a massive scale, with a hartal being observed in all corners of the province on February 3rd, 1928. On the occasion of Simon’s arrival in the city, demonstrations were conducted in Calcutta. The Nehru Report: The British justified that ‘disharmony among the various groups in the country’ was the reason why Indians were not included in the Simon Commission. In 1925 and 1927, Lord Birkenhead, the Secretary of State, had challenged the Indian leaders to draft a constitution to which all parties would agree (keeping the communal disunity in mind). Representative of the congress, the league, the liberals, the Hindu Mahasabha, the central Sikh league, and a number of smaller groups representing labour, business and other interests, met in an all-parties` conference between February and May 1928. A select committee was appointed for the actual drafting of the constitutional scheme. Pandit Motilal Nehru with Tej Bahadur Sapru, sir Ali Imam, Sardar Mangal Singh and Subhas Chandra Bose as its members. The Nehru committee`s report as it was called was submitted on 10 August, 1928. The Nehru report stated that the ‘next immediate step for India must be ‘dominion status’. The Nehru report was approved by the congress at Calcutta in December 1928. Gandhiji sponsored a resolution agreeing to ‘dominion status’ so long as the British accepted the Nehru constitution in its entirety, which should happen in one year. If they did not, congress would `organize a campaign of non-violent non-co-operation` which would include refusal to pay taxes. The failure of the Government to comply with the Nehru report finally made the Congress to launch Civil Disobedience Movement under Gandhiji. The Launch of the Civil Disobedience Movement: First Stage The Congress Committee met at Sabarmati in February, and invested Gandhi and those working with him’ with full authority to lead and direct the Civil Disobedience campaign. Gandhi was urged by the Congress to render his much needed leadership to the Civil Disobedience Movement. Dandi March: On the historic day of 12th March, 1930, Gandhi inaugurated ‘The Civil Disobedience Movement’ by conducting the historic Dandi Salt March, where he broke the Salt Laws imposed by the British Government. Followed by an entourage of seventy nine ashramites, Gandhi embarked on his march from his Sabarmati Ashram to Dandi that is located on the shores of the Arabian Sea. On 6th April 1930, Gandhi with the accompaniment of seventy nine satyagrahis, violated the Salt Law by picking up a fistful of salt lying on the sea shore. They manually made salt on the shores of Dandi. Gandhi-Irwin Pact: In the meantime, the First Round Table Conference was held in 1930, with no Congress member as the participant of the Conference. This led to the meeting of Gandhi and Lord Irwin, the viceroy in March 1931. Here they signed a pact, which came to be known as the Gandhi-Irwin Pact. Accordingly, they agreed on the Discontinuation of the civil disobedience movement by the Indian National Congress participation by the Indian National Congress in the Round Table Conference withdrawal of all ordinances issued by the British Government imposing curbs on the activities of the Indian National Congress withdrawal of all prosecutions relating to several types of offenses except those involving violence release of prisoners arrested for participating in the civil disobedience movement removal of the tax on salt, which allowed the Indians to produce, trade, and sell salt legally and for their own private use. Second Round Table Conference Gandhi attended The Second Round Table Conference in London accompanied by Smt. Sarojini Naidu. At this Conference, it was claimed by Mahatma Gandhi that the Congress represented more than eighty five percent of the Indian population. During this Conference, Gandhi could not reach agreement with the Muslims on Muslim representation and safeguards. Gandhi’s claim of the Congress representing majority was not endorsed by the British and also the Muslim representative. The final blow to Gandhi came when at the end of the conference Ramsay MacDonald undertook to produce a Communal Award for minority representation, with the provision that any free agreement between the parties could be substituted for his award. Thus, the Second Round Table Conference proved to be futile for the Indians and Gandhi returned to the country without any positive result. The political scene in India thereafter assumed an acute dimension. The Viceroy, Lord Willington, in the absence of Gandhi has adopted the policy of repression. The Gandhi-Irwin Pact was violated and the Viceroy took to the suppression of the Congress. The Conservative party, which was in power in England, complied with the decision to assume a repressive stance against the Congress and the Indians. The Congress was also held responsible by the government to have instigated the ‘Red Shirts’ to participate in The Civil Disobedience Movement, led byKhan Abdul Ghaffar and provoking the cultivators of U.P to refuse to pay land revenue. Adding to this was the serious economic crisis that took hold of the country. Under such circumstances, the resumption of The Civil Disobedience Movement was inevitable. Renewal of the Civil Disobedience Movement: Second Stage The Congress Working Committee took the decision to restart The Civil Disobedience Movement, as the British government was not prepared to relent. Gandhi resumed the movement in January, 1932 and appealed to the entire nation to join in. The Viceroy was also informed of the stance assumed by the Congress. The police was given the power to arrest any person, even on the basis of mere suspicion. Sardar Patel, the President of Congress and Gandhi were arrested, along with other Congressmen. Though the second phase of The Civil Disobedience Movement lacked the organization that marked its first phase, nonetheless, the entire nation put up a tough fight and the movement continued for six months. Communal Award, 1932 Meanwhile, the failure of the Second Round Table conference convinced Mr. MacDonald to announce the ‘Communal Award’ on August 16, 1932. According to the Award the right of separate electorate was not only given to the Muslims of India but also to all the minority communities in the country. The Award also declared untouchables as a minority and thus the Hindu depressed classes were given a number of special seats, to be filled from special depressed class electorates in the area where their voters were concentrated. Under the Communal Award, the principle of weightage was also maintained with some modifications in the Muslim minority provinces. Principle of weightage was also applied for Europeans in Bengal and Assam, Sikhs in the Punjab and North West Frontier Province, and Hindus in Sindh and North West Frontier Province. Though the Muslims constituted almost 56 percent of the total population of Punjab, they were given only 86 out of 175 seats in the Punjab Assembly. The Muslim majority of 54.8 percent in Punjab was thus reduced to a minority. The formula favored the Sikhs of Punjab, and the Europeans of Bengal the most. The Award was not popular with any Indian party. Muslims were not happy with the Communal Award, as it has reduced their majority in Punjab and Bengal to a minority. Yet they were prepared to accept it. In its annual session held in November 1933, the All India Muslim League passed a resolution that reads; “Though the decision falls far short of the Muslim demands, the Muslims have accepted it in the best interest of the country, reserving to themselves the right to press for the acceptance of all their demands.” On the other hand, the Hindus refused to accept the awards and decided to launch a campaign against it. For them it was not possible to accept the Untouchables as a minority. They organized the Allahabad Unity Conference in which they demanded for the replacement of separate electorates by joint electorates. Many nationalist Muslims and Sikhs also participated in the conference. The Congress also rejected the Award in Toto. Gandhi protested against the declaration of Untouchables as a minority and undertook a fast unto death. Though he managed to sign the Poona Pact with Dr. B. R. Ambedker, the leader of Untouchables in which the Congress met many of the Untouchables’ demands, the Communal Award was a blow to Gandhiji and he finally decided to suspend and withdraw mass satyagraha on 14th July, 1933. The movement ceased completely on 7th April, 1934.

Rebel Sports NZ Corporate Social Responsibility

term paper help INTRODUCTION Corporate social responsibility- Corporate social responsibility, often abbreviated “CSR,” is a corporation’s initiatives to assess and take responsibility for the company’s effects on environmental and social wellbeing. The term generally applies to efforts that go beyond what may be required by regulators or environmental protection groups. CSR may also be referred to as “corporate citizenship” and can involve incurring short-term costs that do not provide an immediate financial benefit to the company, but instead promote positive social and environmental change. There are different kinds of corporate social responsibilities which are often used by other businesses as well:- ECONOMIC RESPONSIBILITIES- This should be the first thing a company should think of but it is not true if the company is not earning much profit then it is very hard for that organization to survive and take part in social things. Because if the company is in loss than the employees would lose jobs. So before being a good corporate citizen, a company should make sure that is it profitable or not. LEGAL RESPONSIBILITIES- The company’s legal responsibilities are put on by the law itself. After ensuring that the company is going in profit, is the company running according to the laws is more important thing according to the theory of corporate social responsibilities. ETHICAL RESPONSIBILITIES- Ethical and legal responsibilities are two main and important responsibilities of a company’s. Before taking part in social responsibilities a company should meet these two responsibilities first. Ethical responsibilities are those which the company puts on itself not because they are forced to because the owner find it good thing to do. This include becoming environment friendly, paying salaries according to the wages act. THREE THEORIES STRAWMAN THEORY- This theory contain that a person have two personas, one of him/her and the other is the person with written income, legal personality known as the “Strawman”. The idea of this concept is that an individual’s debt, liabilities and other legal responsibilities belong to the strawman. JUST THEORY- Justice is the legal term which admire what is right and what is wrong. The meaning of justice is different in every culture. This theory is defined by so many authors and one of the author JOHN RAWLS shows that justice and especially distributive justice, is a form of fairness by using a social contract argument. RIGHT THEORY: Rights are generally justified claims that protects the general interests. This theory contain that there are thing which we can’t do against anyone because they are moral rights holders. If you don’t have any right you shouldn’t frustrate that interest. Best practice of corporate social responsibilities ANS2- REBEL SPORTS NZ Rebel sports is one of the famous brand name in New Zealand which is mainly for the sports stuff such as gym clothes, swimming suits etc. Rebel is proud partner with community groups and charities that promote an active healthier lifestyle for all the families. Rebel sports support the heart foundation and its jump rope activity for heart program. Rebel sports support jump rope program because the money raised from selling the gears for the jump rope activity is directly sent to charity accounts and to raise awareness among the people about this thing as well. BRISCOE NZ In New Zealand, Briscoe is the brand know by each and every one. This brand is famous for the home ware

Assignment: Paradigm Constraints

Assignment: Paradigm Constraints. Can you help me understand this Business question?

Whether managing a non-profit theater group, a global delivery service, or a fast-growing church, all organizations face constraints. The case studies featured in your readings this week are all very different in terms of their size, structure, markets, and goals, yet each could benefit from constraint and paradigmatic analysis as it grapples with complex business problems.
Review the case studies for the week, and select one for this Assignment. Note that all organizations aim to create value, regardless of whether they are for- or non-profit, public or privately held, large or small. Each case describes an organization that seeks to achieve its goals through its operations and initiatives.
For this Assignment, prepare the first draft of a systems diagram, identifying the primary system archetypes that the case describes. Identify the key paradigm-based constraints that prevent subjects in the case study from seeing other options.
Assignment
For the case you selected, complete the following:

Develop robust systems diagrams that capture the system behaviors and outcomes for your client’s organization. Include a 5-Why effect-cause-effect analysis, and a causal loop diagram (CLD) that identifies appropriate system constraints and delays and that also identifies the key system archetypes described in the case. (1 page for the 5-Whys diagram, 1 page for the full CLD).
Write a persuasive, detailed, prioritized description of your findings and make specific recommendations that integrates the analyses you have performed. (1-2 pages, single-spaced)
Describe the lessons you learned from the case study and explain how you might apply them in the future.

****Case Studies to pick from****
https://services.hbsp.harvard.edu/api/courses/615958/items/UV0938-PDF-ENG/sclinks/ed9a902f2f291cd69e4a4af62797c8e8
https://services.hbsp.harvard.edu/api/courses/615958/items/UV0938-PDF-ENG/sclinks/ed9a902f2f291cd69e4a4af62797c8e8
https://services.hbsp.harvard.edu/api/courses/615958/items/908D01-PDF-ENG/sclinks/c15bcd543563db999380574e785bf29a
Assignment: Paradigm Constraints

California University Health Care Delivery Models & Nursing Practice Discussion

California University Health Care Delivery Models & Nursing Practice Discussion.

I’m working on a nursing Discussion and need an explanation to help me understand better.

Examine changes introduced to reform or restructure the U.S. health care delivery system. In a 1,000-1,250 word paper, discuss action taken for reform and restructuring and the role of the nurse within this changing environment.Include the following:Outline a current or emerging health care law or federal regulation introduced to reform or restructure some aspect of the health care delivery system. Describe the effect of this on nursing practice and the nurse’s role and responsibility.Discuss how quality measures and pay for performance affect patient outcomes. Explain how these affect nursing practice and describe the expectations and responsibilities of the nursing role in these situations.Discuss professional nursing leadership and management roles that have arisen and how they are important in responding to emerging trends and in the promotion of patient safety and quality care in diverse health care settings.Research emerging trends. Predict two ways in which the practice of nursing and nursing roles will grow or transform within the next five years to respond to upcoming trends or predicted issues in health care.You are required to cite to a minimum of three sources to complete this assignment. Sources must be published within the last 5 years and appropriate for the assignment criteria and relevant to nursing practice. Prepare this assignment according to the guidelines found in the APA Style Guide, located in the Student Success Center.___________________________________________________________________________________________________Topic: Case Study on Biomedical Ethics in the Christian NarrativeThis assignment will incorporate a common practical tool in helping clinicians begin to ethically analyze a case. Organizing the data in this way will help you apply the four principles and four boxes approach.Based on the “Case Study: Healing and Autonomy” and other required topic study materials, you will complete the “Applying the Four Principles: Case Study” document that includes the following:Part 1: ChartThis chart will formalize the four principles and four boxes approach and the four-boxes approach by organizing the data from the case study according to the relevant principles of biomedical ethics: autonomy, beneficence, nonmaleficence, and justice.Part 2: EvaluationThis part includes questions, to be answered in a total of 500 words, that describe how principalism would be applied according to the Christian worldview.Remember to support your responses with the topic study materials.APA style is not required, but solid academic writing is expected.
California University Health Care Delivery Models & Nursing Practice Discussion